Sequence retrieval

Genome: Staphylococcus pseudintermedius ED99
Start position: 191792
End position: 191827
Length: 36

DNA sequence
>NC_017568, from 191792 to 191827 (36 bp); Staphylococcus pseudintermedius ED99 ACATCAGCAAGTGAATCAGCAAGTACAGAAGCAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 182229-192737	Sequence	SPSE_0164 spsJ LPXTG-motif cell wall anchor domain-containing protein