Sequence retrieval

Genome: Staphylococcus pseudintermedius ED99
Start position: 2019619
End position: 2019648
Length: 30

DNA sequence
>NC_017568, from 2019619 to 2019648 (30 bp); Staphylococcus pseudintermedius ED99 TGTTGCTGCTGCTGTTGTTGTTGACGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2019337-2020008	Sequence	SPSE_1963 - hypothetical protein (Protein is coded in complementary strand; from 2020008 to 2019337)