Sequence retrieval

Genome: Staphylococcus pseudintermedius ED99
Start position: 2071415
End position: 2071468
Length: 54

DNA sequence
>NC_017568, from 2071415 to 2071468 (54 bp); Staphylococcus pseudintermedius ED99 CTTTCACTTAGTGATTCGCTTTCACTAACTGATTGGCTCTCACTTAATGATTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2068946-2074486	Sequence	SPSE_2009 spsO LPXTG-motif cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 2074486 to 2068946)