Sequence retrieval

Genome: Staphylococcus pseudintermedius ED99
Start position: 2119011
End position: 2119034
Length: 24

DNA sequence
>NC_017568, from 2119011 to 2119034 (24 bp); Staphylococcus pseudintermedius ED99 CATATTCAAATTGATATTGATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2118050-2119381	Sequence	SPSE_2054 - abortive phage resistance protein (Protein is coded in complementary strand; from 2119381 to 2118050)