Sequence retrieval

Genome: Staphylococcus pseudintermedius ED99
Start position: 842898
End position: 842924
Length: 27

DNA sequence
>NC_017568, from 842898 to 842924 (27 bp); Staphylococcus pseudintermedius ED99 AAAAAAACTAAAAAACCTAAAAATACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 842376-843560	Sequence	SPSE_0785 - multidrug-efflux transporter (Protein is coded in complementary strand; from 843560 to 842376)