Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 1529034
End position: 1529069
Length: 36

DNA sequence
>NC_017582, from 1529034 to 1529069 (36 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 CCAGATCCAATGCCACAACCAATGCCACAACCAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1527715-1529310	Sequence	SeseC_01845 fneF collagen-binding collagen-like surface-anchored protein FneF