Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 910767
End position: 910802
Length: 36

DNA sequence
>NC_017582, from 910767 to 910802 (36 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 TGCCTAAGCCAATGCCTAAGCCAGAGCCTAAGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 910029-911093	Sequence	SeseC_01092 - cell surface-anchored protein