Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 1253344
End position: 1253368
Length: 25

DNA sequence
>NC_017582, from 1253344 to 1253368 (25 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 TTTCTTTTGTTTTCCTTGCTTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1253246-1253560	Sequence	SeseC_01489 rplU 50S ribosomal protein L21 (Protein is coded in complementary strand; from 1253560 to 1253246)