Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 1554125
End position: 1554151
Length: 27

DNA sequence
>NC_017582, from 1554125 to 1554151 (27 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 TATTTTATCAATTTTATCTATTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1552104-1554749	Sequence	SeseC_01872 - Purine NTPase (Protein is coded in complementary strand; from 1554749 to 1552104)