Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 2030184
End position: 2030213
Length: 30

DNA sequence
>NC_017582, from 2030184 to 2030213 (30 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 TGGTTGATAGTAGTTGATAAGGGTTGACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2030077-2030646	Sequence	SeseC_02449 - phosphoglycerate mutase family protein (Protein is coded in complementary strand; from 2030646 to 2030077)