Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 219386
End position: 219430
Length: 45

DNA sequence
>NC_017582, from 219386 to 219430 (45 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 CCTTGACCGTTCATACCTTGACCGTTCATACCTTGACCGTTCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 219119-220150	Sequence	SeseC_00246 sclE collagen-like surface-anchored protein SclE (Protein is coded in complementary strand; from 220150 to 219119)