Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 222505
End position: 222540
Length: 36

DNA sequence
>NC_017582, from 222505 to 222540 (36 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 TCACCTTTTTCTCCTTTTTCTCCTTTTTCACCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 222117-222824	Sequence	SeseC_00251 sclZ collagen-like surface protein SclZ.5 (Protein is coded in complementary strand; from 222824 to 222117)