Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 338593
End position: 338664
Length: 72

DNA sequence
>NC_017582, from 338593 to 338664 (72 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 GGCTTAGGCTCTGGCTTAGGCTCTGGCTTAGGCTCTGGCTTAGGCTCTGGCTTAGGCTCTGGCTTAGGCT CT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 338419-339363	Sequence	SeseC_00398 - cell surface-anchored protein (Protein is coded in complementary strand; from 339363 to 338419)