Sequence retrieval

Genome: Streptococcus equi subsp. zooepidemicus ATCC 35246
Start position: 499810
End position: 499857
Length: 48

DNA sequence
>NC_017582, from 499810 to 499857 (48 bp); Streptococcus equi subsp. zooepidemicus ATCC 35246 GGTTCTGGCTTAGGTTTAGGCTTAGGTTCTGGCTGAGGTTTAGGCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 499282-500547	Sequence	SeseC_00598 - fibronectin-binding protein (Protein is coded in complementary strand; from 500547 to 499282)