Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 2506728
End position: 2506757
Length: 30

DNA sequence
>NC_017586, from 2506728 to 2506757 (30 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 GGGCCGGGCCGTTCCGGGCCGGGGCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2506670-2507764	Sequence	SCATT_23580 - putative short chain dehydrogenase (Protein is coded in complementary strand; from 2507764 to 2506670)