Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 1407692
End position: 1407718
Length: 27

DNA sequence
>NC_017586, from 1407692 to 1407718 (27 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 CCTGGCCGCCCTGGCCGCCCTGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1407646-1408437	Sequence	SCATT_12920 - phage shock protein A, PspA (Protein is coded in complementary strand; from 1408437 to 1407646)