Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 3105140
End position: 3105181
Length: 42

DNA sequence
>NC_017586, from 3105140 to 3105181 (42 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 GCGGCTGATCTCACGCGGCTGATCTCACGCGGCTGATCTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3104369-3105148	Sequence	SCATT_29450 - putative transcriptional regulator