Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 3154762
End position: 3154788
Length: 27

DNA sequence
>NC_017586, from 3154762 to 3154788 (27 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 GCGTACGGGGCGTACGGGGCGTACGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3153601-3155274	Sequence	SCATT_29940 - putative serine protease (Protein is coded in complementary strand; from 3155274 to 3153601)