Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 3929992
End position: 3930015
Length: 24

DNA sequence
>NC_017586, from 3929992 to 3930015 (24 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 CGGAGCCGGAGCCGGAGCCGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3929459-3930127	Sequence	SCATT_36540 - hypothetical protein (Protein is coded in complementary strand; from 3930127 to 3929459)