Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 3983387
End position: 3983422
Length: 36

DNA sequence
>NC_017586, from 3983387 to 3983422 (36 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 GCCGGGACCGGGGCCGGGACCGGGGCCGGGACCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3982872-3983612	Sequence	SCATT_36950 - integral membrane protein (Protein is coded in complementary strand; from 3983612 to 3982872)