Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 491467
End position: 491493
Length: 27

DNA sequence
>NC_017586, from 491467 to 491493 (27 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 GGTCGGCGCGGTCGGCGCGGTCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 481112-523807	Sequence	SCATT_04290 - hypothetical protein (Protein is coded in complementary strand; from 523807 to 481112)