Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 5682175
End position: 5682219
Length: 45

DNA sequence
>NC_017586, from 5682175 to 5682219 (45 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 CCGGTCGCCGAAGCACCGGTCGCCGAAGCACCGGTCGCCGAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5681114-5684245	Sequence	SCATT_52670 - nicotinate-nucleotide/dimethylbenzimidazole phosphoribosyltransferase