Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 6281923
End position: 6281952
Length: 30

DNA sequence
>NC_017586, from 6281923 to 6281952 (30 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 CCTTGCCCTTGCCCTTGCCCTTGCCCTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6281547-6281999	Sequence	SCATT_58220 - putative transposase (Protein is coded in complementary strand; from 6281999 to 6281547)