Sequence retrieval

Genome: Streptomyces cattleya NRRL 8057 = DSM 46488
Start position: 894590
End position: 894613
Length: 24

DNA sequence
>NC_017586, from 894590 to 894613 (24 bp); Streptomyces cattleya NRRL 8057 = DSM 46488 CTCGGGCTCGGGCTCGGGCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 894555-894710	Sequence	SCATT_08010 - hypothetical protein (Protein is coded in complementary strand; from 894710 to 894555)