Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 1174142
End position: 1174195
Length: 54

DNA sequence
>NC_017729, from 1174142 to 1174195 (54 bp); Bacillus anthracis str. H9401 TCCAGTTGGCCCAGTTGGTCCAGTTGGTCCAGTTGGTCCAGTTGGCCCAGTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1173630-1174400	Sequence	H9401_1149 - BclA protein (Protein is coded in complementary strand; from 1174400 to 1173630)