Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 1174152
End position: 1174178
Length: 27

DNA sequence
>NC_017729, from 1174152 to 1174178 (27 bp); Bacillus anthracis str. H9401 CCAGTTGGTCCAGTTGGTCCAGTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1173630-1174400	Sequence	H9401_1149 - BclA protein (Protein is coded in complementary strand; from 1174400 to 1173630)