Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 1205643
End position: 1205669
Length: 27

DNA sequence
>NC_017729, from 1205643 to 1205669 (27 bp); Bacillus anthracis str. H9401 TTTCGGTTCTTTTGGTTCTTGCGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1205272-1205703	Sequence	H9401_1185 - Group-specific protein (Protein is coded in complementary strand; from 1205703 to 1205272)