Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 1244810
End position: 1244854
Length: 45

DNA sequence
>NC_017729, from 1244810 to 1244854 (45 bp); Bacillus anthracis str. H9401 TTCAGCAGGCTTTTGCTCGGCAGGTTTTTGCTCAACAGGCTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1244328-1245155	Sequence	H9401_1222 - hypothetical protein (Protein is coded in complementary strand; from 1245155 to 1244328)