Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 1471755
End position: 1471778
Length: 24

DNA sequence
>NC_017729, from 1471755 to 1471778 (24 bp); Bacillus anthracis str. H9401 TTGTTGTTGTTCTTGCTGCTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1471699-1474323	Sequence	H9401_1479 - Penicillin-binding protein (Protein is coded in complementary strand; from 1474323 to 1471699)