Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 220776
End position: 220811
Length: 36

DNA sequence
>NC_017729, from 220776 to 220811 (36 bp); Bacillus anthracis str. H9401 GATTTATAAAGAGCTGTATAAAGAGCTGTATAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 219272-220951	Sequence	H9401_0215 - Oligopeptide transporter, periplasmic-binding protein