Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 2270446
End position: 2270499
Length: 54

DNA sequence
>NC_017729, from 2270446 to 2270499 (54 bp); Bacillus anthracis str. H9401 GCCTGTGGGACCAGTGATGCCTGTGGGACCGGTGATGCCTGTAGGACCAGTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2270021-2270575	Sequence	H9401_2326 - hypothetical protein (Protein is coded in complementary strand; from 2270575 to 2270021)