Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 2556304
End position: 2556339
Length: 36

DNA sequence
>NC_017729, from 2556304 to 2556339 (36 bp); Bacillus anthracis str. H9401 ATCATCTAATGGATCATCTAATGGATCAACTGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2556140-2556781	Sequence	H9401_2623 - Metal-dependent hydrolase (Protein is coded in complementary strand; from 2556781 to 2556140)