Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 2578849
End position: 2578884
Length: 36

DNA sequence
>NC_017729, from 2578849 to 2578884 (36 bp); Bacillus anthracis str. H9401 AATTCCAATTACAATTCCAATCACAATTCCGATTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2578832-2579002	Sequence	H9401_2654 - hypothetical protein (Protein is coded in complementary strand; from 2579002 to 2578832)