Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 2636798
End position: 2636821
Length: 24

DNA sequence
>NC_017729, from 2636798 to 2636821 (24 bp); Bacillus anthracis str. H9401 ATAAATATAAACATGAATATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2636561-2636812	Sequence	H9401_2720 - cell division protein (Protein is coded in complementary strand; from 2636812 to 2636561)