Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 3152064
End position: 3152099
Length: 36

DNA sequence
>NC_017729, from 3152064 to 3152099 (36 bp); Bacillus anthracis str. H9401 AAGAATCTGTTCAAGAATCTGTTCAAGAATATGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3151470-3152477	Sequence	H9401_3271 - Oxidoreductase, zinc-binding dehydrogenase family