Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 3404346
End position: 3404369
Length: 24

DNA sequence
>NC_017729, from 3404346 to 3404369 (24 bp); Bacillus anthracis str. H9401 TATCAACATCAATAGCAATAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3403274-3404932	Sequence	H9401_3528 - urocanate hydratase (Protein is coded in complementary strand; from 3404932 to 3403274)