Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 3510924
End position: 3510959
Length: 36

DNA sequence
>NC_017729, from 3510924 to 3510959 (36 bp); Bacillus anthracis str. H9401 TTCTTTTTCATTTTCTTTTTCATTTTCTTTTTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3509530-3511410	Sequence	H9401_3659 - PTS system fructose-specific transporter subunit IIABC (Protein is coded in complementary strand; from 3511410 to 3509530)