Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 3584466
End position: 3584510
Length: 45

DNA sequence
>NC_017729, from 3584466 to 3584510 (45 bp); Bacillus anthracis str. H9401 TTGTTCCTCTTTCTTCGGTTCTTCTTTCTTTGGTTCCTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3584110-3585021	Sequence	H9401_3733 - transcriptional regulator (Protein is coded in complementary strand; from 3585021 to 3584110)