Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 3698969
End position: 3698992
Length: 24

DNA sequence
>NC_017729, from 3698969 to 3698992 (24 bp); Bacillus anthracis str. H9401 AATCTTCAAACCTTCAAATCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3698505-3699425	Sequence	H9401_3839 - aspartate carbamoyltransferase (Protein is coded in complementary strand; from 3699425 to 3698505)