Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 3765096
End position: 3765125
Length: 30

DNA sequence
>NC_017729, from 3765096 to 3765125 (30 bp); Bacillus anthracis str. H9401 TTTTTCTTTTCTTTTTTTCTTATTTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3765013-3765183	Sequence	H9401_3911 - hypothetical protein (Protein is coded in complementary strand; from 3765183 to 3765013)