Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 3821179
End position: 3821202
Length: 24

DNA sequence
>NC_017729, from 3821179 to 3821202 (24 bp); Bacillus anthracis str. H9401 CAAGTGCAAGTCCAACTGCAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3820419-3821396	Sequence	H9401_3988 - Pyruvate dehydrogenase complex E1 component, beta subunit (Protein is coded in complementary strand; from 3821396 to 3820419)