Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 3968222
End position: 3968257
Length: 36

DNA sequence
>NC_017729, from 3968222 to 3968257 (36 bp); Bacillus anthracis str. H9401 TGCTCTGCAACTTGCATTGCAACTTGCTCTCCAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3967517-3968320	Sequence	H9401_4156 - Oxidoreductase, short-chain dehydrogenase/reductase family (Protein is coded in complementary strand; from 3968320 to 3967517)