Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 407014
End position: 407073
Length: 60

DNA sequence
>NC_017729, from 407014 to 407073 (60 bp); Bacillus anthracis str. H9401 CCAGAACCGTTGCCGCCAGAACCATTTTCGCCAGAACCGTTGCCACCAGAACCGTTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 406501-407334	Sequence	H9401_0376 - LPXTG-motif cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 407334 to 406501)