Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 4094141
End position: 4094188
Length: 48

DNA sequence
>NC_017729, from 4094141 to 4094188 (48 bp); Bacillus anthracis str. H9401 CAATATCAACAACAATATCAACAACAATATCAACAACAATATCAACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4094053-4094226	Sequence	H9401_4303 - hypothetical protein (Protein is coded in complementary strand; from 4094226 to 4094053)