Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 4322990
End position: 4323016
Length: 27

DNA sequence
>NC_017729, from 4322990 to 4323016 (27 bp); Bacillus anthracis str. H9401 GTTGCTCCTGTTGCTCCTGTTGCTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4322420-4323358	Sequence	H9401_4547 - Collagen triple helix repeat domain protein (Protein is coded in complementary strand; from 4323358 to 4322420)