Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 4422792
End position: 4422815
Length: 24

DNA sequence
>NC_017729, from 4422792 to 4422815 (24 bp); Bacillus anthracis str. H9401 TATTCTCTTATGCTCTTGTTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4422526-4423221	Sequence	H9401_4652 - Membrane protein (Protein is coded in complementary strand; from 4423221 to 4422526)