Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 445202
End position: 445237
Length: 36

DNA sequence
>NC_017729, from 445202 to 445237 (36 bp); Bacillus anthracis str. H9401 AATACAGAGAATACTACAAAGAATACTACAGAGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 444675-445556	Sequence	H9401_0417 - Prophage LambdaBa04, DnaD replication protein