Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 4477295
End position: 4477348
Length: 54

DNA sequence
>NC_017729, from 4477295 to 4477348 (54 bp); Bacillus anthracis str. H9401 ACCGGTGCTTCTTCTGCAACTGGTTGTTCTTCTGCAATCGGTGTTTCTTCTACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4474967-4478938	Sequence	H9401_4715 - FtsK/SpoIIIE family protein (Protein is coded in complementary strand; from 4478938 to 4474967)