Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 4518815
End position: 4518841
Length: 27

DNA sequence
>NC_017729, from 4518815 to 4518841 (27 bp); Bacillus anthracis str. H9401 TTGTTGATATTGTTGATATTGTTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4518708-4519478	Sequence	H9401_4767 - VrrB (Protein is coded in complementary strand; from 4519478 to 4518708)