Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 4679225
End position: 4679248
Length: 24

DNA sequence
>NC_017729, from 4679225 to 4679248 (24 bp); Bacillus anthracis str. H9401 CTTTTACTTTCACTTTCACTTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4678150-4684170	Sequence	H9401_4927 - Cell surface protein (Protein is coded in complementary strand; from 4684170 to 4678150)